Identificazione di specie ittiche

Identificazione di specie ittiche

Negli ultimi anni la richiesta di prodotti della pesca è notevolmente aumentata. In seguito alla globalizzazione dei mercati e alla conseguente importazione da ogni parte del mondo di prodotti ittici, deve essere posta particolare attenzione al rischio sanitario connesso al consumo di questi prodotti. Inoltre, sempre più frequentemente i prodotti ittici vengono commercializzati già preparati e pronti per il consumo (convenience food), non rendendo sempre possibile riconoscere la specie in base alle sole caratteristiche morfologiche. Di qui la necessità di specifiche tecniche di laboratorio che siano di supporto all’ispettore sanitario e diventino garanzia per il consumatore.

Riconoscere e identificare le specie ittiche tutela il consumatore sul lato economico-commerciale, ostacolando le frodi alimentari (sostituzione di una specie ittica con una di minor pregio), ma soprattutto da possibili rischi per la propria salute: per esempio, basti ricordare quanto accaduto in Italia alla fine degli anni settanta, quando alcune persone morirono avvelenate da tetrodotossina per aver mangiato tranci di pesce palla al posto di falsamente dichiarate code di rospo. D’altra parte le normative in materia di rintracciabilità dei prodotti ittici (reg. CE 104/2000, reg. CE 2065/2001, reg. UE 178/2002) nonché i principi ispiratori dei regolamenti UE n. 852, 853 e 854/2004 applicati dal gennaio 2006 sono la dimostrazione di come oggi più che mai il consumatore ha il diritto di conoscere quello che giunge sul suo piatto ed essere tutelato.

Perché è importante saper riconoscere le specie ittiche?

Di seguito sono specificati nel dettaglio alcuni dei motivi principali per cui è l’attività di identificazione di specie ittiche risulta importante per evitare frodi alimentari e rischi per il consumatore.

  • Oltre ai tetraodontidae, anche altrefamiglie sono considerate velenosecanthigasteridaediodontidaemolidae (regolamento UE 853/2004), a cui vanno aggiunti alcuni squaliformi (es. Somniosus microcephalus e Carcharhinus leucas) e la famiglia dei gempilidae (Ruvettus pretiosus – il cosiddetto oilfish e Lepydocibium flavobrunneum – c.d. escolar), questi ultimi oggetto di uno specifico divieto di commercializzazione sul territorio nazionale data la presenza di tali pesci nelle acque nazionali, salvo che il prodotto non sia accompagnato da specifiche informazioni per il consumatore riguardanti la corretta modalità di cottura per allontanare la componente tossica dai tessuti (cfr. nota Min. 15420/AL.22 ISS, Uff. IX del 5/7/1999 nonché la nota EFSA del 30/8/2004, question n. Q 2004, 016 ed il Reg. UE 2074/2005).
  • A causa dei cambiamenti climatici che stanno determinando un innalzamento della temperatura delle acque marine, sono in aumento le segnalazioni della presenza nel Mar Mediterraneo di fauna ittica denominata “Lessepsiana”, dal nome del costruttore del Canale di Suez, il francese Ferdinand de Lesseps. Accade, infatti, che pesci dall’Oceano Indiano e dal Mar Rosso risalgono fino al Mediterraneo attraverso il Canale di Suez. Può pertanto capitare che pesci potenzialmente tossici, prima assenti nelle nostre acque, vengano pescati ed entrino così nei circuiti commerciali, come i tetraodontidae Sphoeroides pachigaster, Lagocephalus spadiceus e Lagocephalus sceleratus. Quest’ultima specie è stata responsabile nel 2004 di otto decessi proprio nella città di Suez, in Egitto.
  • In alcuni casi ci possono essere risvolti sanitari da una frode alimentare quando la zona di provenienza del pesce non corrisponde a quella reale: si pensi per esempio alla sostituzione di bivalvi sgusciati precotti nostrani con bivalvi esotici, non sempre raccolti in aree controllate per la presenza di biotossine. Oppure alla sostituzione di filetti di pesce persico nostrano (Perca fluviatilis), oppure di cernia (Epinephelus spp.), con il persico africano (Lates niloticus), quest’ultimo più volte sottoposto a divieti commerciali per problemi igienico-sanitari perché proveniente da zone con acque inquinate. La vendita di pesce serra (Pomatomus saltator) al posto di branzino (Dicentrarchus labrax), può determinare problemi di intossicazione in quanto il pesce serra contiene maggiori quantità di istidina, amminoacido naturalmente presente nelle masse muscolari, che in pesce poco fresco viene decarbossilato in istamina, ammina biogena tossica.
  • Nel caso di tranci di tonni commercializzati freschi o congelati, dove il colore originale varia dal rosa chiaro dell’alalunga (Thunnus alalunga) al più scuro tonno rosso (Thunnus thynnus), determinare la specie esatta può essere d’aiuto nel capire se il colore della carne è effettivamente naturale, oppure se è stato trattato con sostanze esogene vietate in Italia come il monossido di carbonio (CO), sostanza gassosa impiegata come additivo che mantiene ravvivato il colore dei tessuti fissando la carbossiemoglobina al posto dell’ossiemoglobina. Nell’Unione europea è proibito l’impiego di CO negli alimenti.
  • La possibilità di commercializzazione di preparazioni alimentari contenenti pesce al posto di crostacei o di molluschi, esponendo così la categoria dei consumatori allergici a possibili rischi per la loro salute. La direttiva 2003/89/CE ed il Regolamento UE 1169/2011 specificano, infatti, che la presenza di pesce, molluschi  e  crostacei venga appositamente specificata tra gli ingredienti, perché appunto potenzialmente allergizzanti.
  • L’identificazione è importante anche per garantire il rispetto di norme religiose. Per esempio, secondo il Kasher ebraico, tra le regole che governano la nutrizione degli ebrei osservanti sono esclusi dal consumo i pesci senza pinne e squame (es. anguilla, squali), i crostacei e i molluschi.
  • Ci possono essere anche motivazioni di tipo protezionistico, nel caso in cui vengono avviati alla trasformazione e al successivo consumo animali marini protetti come i delfini ed alcune specie di squaliformi.
Attività, laboratori e referentiIttiobaseMetodiche di identificazioneNormativa

Attività e laboratori IZSVe sull’identificazione delle specie ittiche

L’Istituto Zooprofilattico Sperimentale delle Venezie ha attivato presso il Centro specialistico ittico uno specifico reparto per la determinazione delle specie ittiche, impiegando metodi ispettivi e biomolecolari.

Grazie al lavoro di personale altamente specializzato, composto da biologi e biotecnologi, è in grado di far fronte a richieste di identificazione di specie ittiche di provenienza regionale e nazionale. L’attività svolta dal Centro è in particolar modo di supporto a veterinari, vigili sanitari, carabinieri del NAS, ufficiali delle capitanerie di porto, guardie di finanza, chiamati a tutelare il consumatore riguardo la salubrità dei prodotti, ma che sempre più spesso si trovano in difficoltà nel riconoscimento della specie.

In queste pagine è possibile consultare Ittiobase il database delle specie ittiche identificate dall’IZSVe che raccoglie le sequenze genetiche di specie comunemente commercializzate in Italia.


Referente IZSVe per l’identificazione delle specie ittiche

Giuseppe Arcangeli
Centro specialistico ittico
Tel: 049 8084281 – 0426 21811
E-mail: garcangeli@izsvenezie.it
Visualizza profilo >

Ittiobase

IttiobaseIttiobase | Identificazione specie ittiche | IZSVe è un database in continuo ampliamento che raccoglie varie informazioni riguardanti le specie ittiche di interesse commerciale. Il database risponde alla necessità di avere a disposizione sequenze certe di riferimento per tutti i laboratori che effettuano analisi di identificazione di specie ittiche. Per sequenze certe si intende sequenze derivanti da campioni di pesci interi freschi o congelati, identificati morfologicamente mediante chiavi dicotomiche FAO da personale altamente specializzato. Inoltre, i campioni sono georeferenziati almeno a livello di macroaree FAO.

Per ogni specie presente in Ittiobase sono state analizzate e inserite dieci sequenze derivanti da 10 esemplari diversi, partendo da pesci interi con luogo di pesca georeferenziati e identificati morfologicamente secondo i criteri proposti dai manuali FAO. Per ciascun individuo è possibile trovare la sequenza ottenuta mediante l’amplificazione del gene maggiormente utilizzato a livello internazionale per il barcoding di specie (COI).

Sono state create delle schede tecniche facilmente consultabili e di semplice comprensione in cui sono presenti informazioni di carattere generale come la nomenclatura, le zone di distribuzione, le caratteristiche commerciali e i problemi collegati alla sicurezza alimentare e alle frodi. All’interno del database sono inoltre presenti i tracciati IEF di varie specie di interesse commerciale.

Accedi a Ittiobase »

Contribuisci anche tu all’aggiornamento di Ittiobase

Anche laboratori esterni possono contribuire all’implementazione del database. Bastano tre passaggi:

  1. Contattare il Centro specialistico ittico dell’IZSVe
    Contatti di riferimento: Federica Tosi, tel. 049 8084103, e-mail: ftosi@izsvenezie.it
    Vi verranno fornite tutte le informazioni necessarie per poter considerare valide le sequenze e i campioni in oggetto.
  1. Compilazione del format e invio dei prodotti
    Compilare il format Scheda campionamento specie ittiche – PDF e inviarlo via e-mail al personale di riferimento del Centro specialistico ittico. In contemporanea, verrà organizzato con il Centro il trasporto del campione biologico.
  1. Inserimento nel database dei campioni ricevuti
    I campioni inviati saranno presi in consegna dal Centro e, se ritenuti idonei, verranno sottoposti ad analisi. Se gli esiti delle analisi risulteranno concordi con quanto dichiarato nel format, le sequenze verranno inserite in Ittiobase.

Dall’avvenuta consegna dei campioni al Centro devono trascorrere mediamente 15 giorni lavorativi per avere il risultato dell’idoneità dei campioni inviati. Ricevuta l’idoneità, i dati verranno inseriti nel database e il nominativo dell’ente/laboratorio inviante verrà inserito tra i “collaboratori esterni” nella sezione “Contatti” dell’applicazione.

Metodiche di identificazione

Identificazione morfologica

Pesci interi, con la cute integra, non eviscerati e forniti di pinne e eventuali appendici cutanee, sono stati identificati applicando le chiavi di riconoscimento proposte dalla FAO e reperibili sul sito web www.fao.org/fishery/species/search/en, che a sua volta rimanda a specifiche monografie riguardo quel gruppo tassonomico.

Per esempio, per i pesci del Mar Mediterraneo la monografia di riferimento è stata: W. Fischer, M.L. Bauchot and M. Schneider (eds.) Fiches FAO d’identification pour les besoins de la pêche. (rev. 1). Méditerranée et mer Noire. Zone de pêche 37. Vol. II. Commission des Communautés Européennes and FAO, 1987, Rome. 

Prova di sequenziamento

Il prodotto di amplificazione ottenuto viene quantificato e purificato per poter essere sottoposto alla reazione di sequenziamento. La purificazione si ottiene tramite l’uso del kit commerciale “Illustra ExoSTAR-1” (Fisher Scientific) seguendo le indicazioni del fornitore. Nel caso di prodotti di PCR contenenti bande multiple e aspecifiche, si procede con l’estrazione della banda della lunghezza attesa tramite l’uso del kit “Qiaquick Gel Extraction” (Qiagen) e la sua successiva quantificazione.

L’amplificato purificato viene quindi sottoposto a reazione di sequenziamento utilizzando entrambi i primers di amplificazione, ottenendo così due sequenze complementari (figura del ferogramma). Per la reazione di sequenziamento si utilizza il kit “BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies) in un volume finale di 10 µl contenenti: 1 µl di primer specifico (concentrazione 3.3 µM), 1,5 µl di Sequencing Buffer, 1 µl di TRRM, da 1 a 6,5 µl di DNA (a seconda della quantità dell’amplificato). La mix così ottenuta viene sottoposta ad una reazione di PCR con le seguenti condizioni termiche: 25 cicli di 96°C per 10 secondi, 50°C per 5 secondi e 60°C per 2 minuti.

Il prodotto di amplificazione della reazione di sequenza viene successivamente purificato per la rimozione dei reagenti in eccesso. A seconda del numero di amplificati da sequenziare si utilizzano due diversi kit commerciali: “Illustra AutoSeq G-50 Dye Terminator Removal” (GE-Healthcare) nel caso di un numero limitato di amplificati, “Performaâ DTR Ultra 96-Well Plates kit (Edge Biosystem) nel caso di un numero elevato di amplificati da analizzare.

I campioni così ottenuti vengono caricati nel sequenziatore (ABI Prism 3130xl Genetic Analyzer (Applied Biosystems) per l’elettroforesi capillare. Le sequenze ottenute (figura della sequenza) vengono analizzate con i softwares dedicati Sequencing Analysis 5.2 e SeqScape v2.5 seguendo le specifiche del fornitore.

Metodiche biomolecolari per identificazione specie ittiche

Esempio di elettroferogramma. I due tracciati sono relativi ai due strand complementari amplificati con i due primers di apmlificazione. In alto si trova la sequenza di riferimento con la quale comparare le sequenze ottenute (sequenza del cytochrome oxidase subunit I (COI) gene).

 

AAGATATTGGCACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATGGTGGGCACAGCCCTAAGTCTCCTAA
ATCCGTGCAGAACTTAGCCAACCTGGGGCTCTCCTTGGAGACGACCAGATCTATAATGTTATTGTTACTGCA
CATGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTCTAATTGGAGGGTTTGGAAACTGACTAATTCCTC
TTATGATCGGAGCGCCAGATATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTTCCCCCCTCATT
CCTCCTACTACTAGCCTCCTCCGGAGTTGAAGCCGGGGCGGGGACCGGGTGAACGGTATATCCTCCTCTGTC
AGGAAATCTGGCCCATGCAGGAGCATCAGTTGACCTAACCATTTTTTCACTTCATCTAGCAGGTATTTCCTCT
ATTCTAGGGGCCATTAATTTCATTACCACAATTATTAATATGAAACCACCCGCAATCTCACAATACCAAACGC
CTCTGTTTGTCTGATCCGTTCTTGTTACAGCTGTTCTACTTCTTCTATCGCTGCCTGTGCTAGCTGCCGGAATT
ACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATTCTAT

Esempio di sequenza finale ottenuta dal campione in figura. Dopo analisi BLAST questa sequenza è stata identificata come Clupea harengus cytochrome oxidase subunit I (COI) gene.

Normativa

Nel settore ittico il punto di partenza per la filiera diventa la conoscenza dell’origine del prodotto pescato o allevato che sia. A tal proposito il Regolamento UE 1379/2013  prevede che, in fase di vendita al dettaglio, il prodotto fresco, surgelato, salato ed essiccato, riporti le seguenti informazioni obbligatorie (art.1):

  • la denominazione commerciale della specie
  • il metodo di produzione: pescato, pescato in acque dolci o allevato
  • la zona di cattura, secondo le zone FAO.

Per tutte le altre fasi di commercializzazione (art. 2), oltre ai suddetti punti, deve essere aggiunta la denominazione scientifica della specie interessata (secondo la nomenclatura binomia). Quindi, ad esempio, per una pescheria, che vende il prodotto al dettaglio un branzino dovrà essere così identificato:

  • specie: branzino;
  • metodo di cattura: pescato;
  • origine: mare Mediterraneo (oppure zona FAO n.37).

Invece per un commerciante all’ingrosso l’identificazione dovrà contenere anche la corretta denominazione latina:

  • Specie: branzino (Dicentrarchus labrax)
  • Metodo di cattura: pescato
  • Origine: mare Mediterraneo (oppure zona FAO n.37)

Il Ministero della Marina mercantile, il 15 luglio 1983 ha emanato la prima lista di prodotti ittici con denominazione commerciale obbligatoria, cui sono seguite negli anni altre liste aggiornate, fino all’ultimo decreto, emanato dal MiPAAF nel 2017 (G.U. n. 266 del 14/11/2017). Questo significa che se una specie è prevista nell’elenco deve essere denominata solo ed esclusivamente con quel nome commerciale. Una specie che non figura nell’elenco può essere commercializzata con una denominazione commerciale provvisoria stabilita dall’autorità competente dello Stato membro della UE, previa comunicazione al MiPAAFT da parte dell’Autorità Sanitaria competente per territorio. Un esempio: il Morone saxatilis, specie di acqua dolce di origine nord mericana, era chiamato “branzino striato”, ma da quando è stata inserita nell’elenco ufficiale, è d’obbligo la denominazione “persico-spigola”.

Riferimenti normativi

  • Decreto MIPAAF del 27/03/2002 in applicazione dei Regolamenti (CE) n. 104/2000 e n. 2065/2001 (recepisce per l’Italia quanto previsto relativamente all’etichettatura e ai sistemi di controllo per i prodotti ittici), GU n. 84 del 10/04/2002
  • Decreto MIPAAF del 25 luglio 2005, Modifiche e integrazioni all’elenco delle denominazioni commerciali dei prodotti ittici, allegato al decreto ministeriale 14 gennaio 2005. G U n. 181 del 5/08/2005
  • Decreto MIPAAF del 31/01/2008, denominazione in lingua italiana delle specie ittiche indicate nell’elenco allegato che costituisce parte integrante del presente decreto e che sostituisce l’elenco allegato al decreto ministeriale del 25/07/2005, GU n. 45 del 22 /02/2008
  • Decreto MIPAAF del 5/03/2010, integrazione elenco decreto ministeriale del 31/01/2008, GU n. 124 del 29/05/2010
  • Decreto MiPAAF del 12/08/2011, Attribuzione della denominazione in lingua italiana di alcune specie ittiche, G.U. n. 208 del 07/09/2011
  • Decreto MiPAAF del 22/09/2017, Denominazione in lingua italiana delle specie ittiche di interesse commerciale, G.U. n. 266 del 14/11/2017

Ultime news

Le frodi alimentari nei prodotti ittici [Video]

Le frodi alimentari nei prodotti ittici [Video]

La corretta informazione alimentare è un diritto dei consumatori sancito dalle leggi europee per mettere ognuno nelle condizioni di fare scelte…

Leggi tutto >

Identificazione di specie di molluschi bivalvi mediante pirosequenziamento

Identificazione di specie di molluschi bivalvi mediante pirosequenziamento

Lo sviluppo del commercio dei prodotti ittici negli ultimi anni a livello globale ha segnato anche un aumento delle frodi commerciali di prodotti…

Leggi tutto >

Prodotti ittici in mensa: quali rischi alimentari in scuole, ospedali e case di cura?

Prodotti ittici in mensa: quali rischi alimentari in scuole, ospedali e case di cura?

Negli ultimi anni pesci, molluschi e crostacei sono diventati un alimento sempre più richiesto dalle mense pubbliche di ospedali, case di cura…

Leggi tutto >

Puoi visualizzare tutte le notizie, gli aggiornamenti e gli approfondimenti su questo tema nella sezione “News” del sito, alla pagina News > News per temi > Alimenti sicuri > Identificazione di specie ittiche

Vai alle news sul tema Identificazione di specie ittiche »