Istituto Zooprofilattico Sperimentale delle Venezie
Ente sanitario di prevenzione, ricerca e servizi per la salute animale e la sicurezza alimentare
Presentazione >
+39 049 8084211

Identificazione di specie ittiche

Identificazione di specie ittiche

Negli ultimi anni la richiesta di prodotti della pesca è notevolmente aumentata. In seguito alla globalizzazione dei mercati e alla conseguente importazione da ogni parte del mondo di prodotti ittici, deve essere posta particolare attenzione al rischio sanitario connesso al consumo di questi prodotti. Inoltre, sempre più frequentemente i prodotti ittici vengono commercializzati già preparati e pronti per il consumo (convenience food), non rendendo sempre possibile riconoscere la specie in base alle sole caratteristiche morfologiche. Di qui la necessità di specifiche tecniche di laboratorio che siano di supporto all’ispettore sanitario e diventino garanzia per il consumatore.

Riconoscere e identificare le specie ittiche tutela il consumatore sul lato economico-commerciale, ostacolando le frodi alimentari (sostituzione di una specie ittica con una di minor pregio), ma soprattutto da possibili rischi per la propria salute: per esempio, basti ricordare quanto accaduto in Italia alla fine degli anni settanta, quando alcune persone morirono avvelenate da tetrodotossina per aver mangiato tranci di pesce palla al posto di falsamente dichiarate code di rospo. D’altra parte le normative in materia di rintracciabilità dei prodotti ittici (reg. CE 104/2000, reg. CE 2065/2001, reg. UE 178/2002) nonché i principi ispiratori dei regolamenti UE n. 852, 853 e 854/2004 applicati dal gennaio 2006 sono la dimostrazione di come oggi più che mai il consumatore ha il diritto di conoscere quello che giunge sul suo piatto ed essere tutelato.

Perché è così importante saper riconoscere le specie ittiche?

Di seguito sono specificati nel dettaglio alcuni dei motivi principali per cui è l’attività di identificazione di specie ittiche risulta importante per evitare frodi alimentari e rischi per il consumatore.

  • Oltre ai tetraodontidae, anche altre famiglie sono considerate velenose: canthigasteridae, diodontidae, molidae (regolamento UE 853/2004), a cui vanno aggiunti alcuni squaliformi (es. Somniosus microcephalus e Carcharhinus leucas) e la famiglia dei gempilidae (Ruvettus pretiosus – il cosiddetto oilfish e Lepydocibium flavobrunneum – c.d. escolar), questi ultimi oggetto di uno specifico divieto di commercializzazione sul territorio nazionale data la presenza di tali pesci nelle acque nazionali (cfr. nota Min. 15420/AL.22 ISS, Uff. IX del 5/7/1999 nonché la nota EFSA del 30/8/2004, question n. Q 2004, 016), salvo che il prodotto non sia accompagnato da specifiche informazioni per il consumatore riguardanti la corretta modalità di cottura per allontanare la componente tossica dai tessuti (cfr. Linee guida nazionali sui prodotti della pesca, conferenza stato regioni 2007 – suppl. ord. Alla G.U. n. 68 del 22 marzo 2007).
  • A causa dei cambiamenti climatici che stanno determinando un innalzamento della temperatura delle acque marine, sono in aumento le segnalazioni della presenza nel Mar Mediterraneo di fauna ittica denominata “Lessepsiana”, dal nome del costruttore del Canale di Suez, il francese Ferdinand de Lesseps. Accade, infatti, che pesci dall’Oceano Indiano e dal Mar Rosso risalgono fino al Mediterraneo attraverso il Canale di Suez. Può pertanto capitare che pesci potenzialmente tossici, prima assenti nelle nostre acque, vengano pescati ed entrino così nei circuiti commerciali, come i tetraodontidae Sphoeroides pachigaster, Lagocephalus spadiceus e Lagocephalus sceleratus. Quest’ultima specie è stata responsabile nel 2004 di otto decessi proprio nella città di Suez, in Egitto.
  • In alcuni casi ci possono essere risvolti sanitari da una frode alimentare quando la zona di provenienza del pesce non corrisponde a quella reale: si pensi per esempio alla sostituzione di bivalvi sgusciati precotti nostrani con bivalvi esotici, non sempre raccolti in aree controllate per la presenza di biotossine. Oppure alla sostituzione di filetti di pesce persico nostrano (Perca fluviatilis), oppure di cernia (Epinephelus spp.), con il persico africano (Lates niloticus), quest’ultimo più volte sottoposto a divieti commerciali per problemi igienico-sanitari perché proveniente da zone con acque inquinate. La vendita di pesce serra (Pomatomus saltator) al posto di branzino (Dicentrarchus labrax), può determinare problemi di intossicazione in quanto il pesce serra contiene maggiori quantità di istidina, amminoacido naturalmente presente nelle masse muscolari, che in pesce poco fresco viene decarbossilato in istamina, ammina biogena tossica.
  • Nel caso di tranci di tonni commercializzati freschi o congelati, dove il colore originale varia dal rosa chiaro dell’alalunga (Thunnus alalunga) al più scuro tonno rosso (Thunnus thynnus), determinare la specie esatta può essere d’aiuto nel capire se il colore della carne è effettivamente naturale, oppure se è stato trattato con sostanze esogene vietate in Italia come il monossido di carbonio (CO), sostanza gassosa impiegata come additivo che mantiene ravvivato il colore dei tessuti fissando la carbossiemoglobina al posto dell’ossiemoglobina. Nell’Unione europea è proibito l’impiego di CO negli alimenti.
  • La possibilità di commercializzazione di preparazioni alimentari contenenti pesce al posto di crostacei o di molluschi, esponendo così la categoria dei consumatori allergici a possibili rischi per la loro salute. La direttiva 2003/89/CE specifica, infatti, che la presenza di pesce e di crostacei venga appositamente specificata tra gli ingredienti, perché appunto potenzialmente allergizzanti.
  • L’identificazione è importante anche per garantire il rispetto di norme religiose. Per esempio, secondo il Kasher ebraico, tra le regole che governano la nutrizione degli ebrei osservanti sono esclusi dal consumo i pesci senza pinne e squame (es. anguilla, squali), i crostacei e i molluschi.
  • Ci possono essere anche motivazioni di tipo protezionistico, nel caso in cui vengono avviati alla trasformazione e al successivo consumo animali marini protetti come i delfini.

Attività IZSVe

L’Istituto Zooprofilattico Sperimentale delle Venezie ha attivato presso il Centro specialistico di ittiopatologia uno specifico reparto per la determinazione delle specie ittiche, impiegando metodi sia isoelettroforetici che biomolecolari.

Grazie al lavoro di personale altamente specializzato, composto da biologi e biotecnologi, è in grado di far fronte a richieste di identificazione di specie ittiche di provenienza regionale e nazionale. L’attività svolta dal Centro è in particolar modo di supporto a veterinari, vigili sanitari, carabinieri del NAS, ufficiali delle capitanerie di porto, guardie di finanza, chiamati a tutelare il consumatore riguardo la salubrità dei prodotti, ma che sempre più spesso si trovano in difficoltà nel riconoscimento della specie.

In queste pagine è possibile consultare Ittiobase il database delle specie ittiche identificate dall’IZSVe che raccoglie le sequenze genetiche e i tracciati isoelettroforetici di specie comunemente commercializzate in Italia

IttiobaseMetodiche di identificazioneNormative / Catalogo specie itticheContatti

Ittiobase

IttiobaseIttiobase | Identificazione specie ittiche | IZSVe è un database in continuo ampliamento che raccoglie varie informazioni riguardanti le specie ittiche di interesse commerciale. Il database risponde alla necessità di avere a disposizione sequenze certe di riferimento per tutti i laboratori che effettuano analisi di identificazione di specie ittiche. Per sequenze certe si intende sequenze derivanti da campioni di pesci interi freschi o congelati, identificati morfologicamente mediante chiavi dicotomiche FAO da personale altamente specializzato. Inoltre, i campioni sono georeferenziati almeno a livello di macroaree FAO.

Per ogni specie presente in Ittiobase sono state analizzate e inserite dieci sequenze derivanti da 10 esemplari diversi, partendo da pesci interi con luogo di pesca georeferenziati e identificati morfologicamente secondo i criteri proposti dai manuali FAO. Per ciascun individuo è possibile trovare la sequenza ottenuta mediante l’amplificazione del gene maggiormente utilizzato a livello internazionale per il barcoding di specie (COI).

Sono state create delle schede tecniche facilmente consultabili e di semplice comprensione in cui sono presenti informazioni di carattere generale come la nomenclatura, le zone di distribuzione, le caratteristiche commerciali e i problemi collegati alla sicurezza alimentare e alle frodi. All’interno del database sono inoltre presenti i tracciati IEF di varie specie di interesse commerciale.

Accedi a Ittiobase »

Si ringrazia il Ministero delle politiche agricole, alimentari e forestali per il contributo concesso a supporto dell’implementazione del database (decreto del 20 dicembre 2012, prot. 33018).

Contribuisci anche tu all’aggiornamento di Ittiobase

Anche laboratori esterni possono contribuire all’implementazione del database. Bastano 3passaggi:

  1. Telefonare o contattare mediante e-mail i seguenti contatti
    Federica Tosi, e-mail: ftosi@izsvenezie.it
    Centro specialistico di ittiopatologia
    via L. da Vinci, 39 45011 Adria (RO) tel.: +39 0426 21841 | fax: +39 0426 901411
    Vi verranno fornite tutte le informazioni necessarie per poter considerare valide le sequenze e i campioni in oggetto.
  1. Compilazione del format e invio dei prodotti
    Compilare il format Scheda campionamento specie ittiche – PDF e inviarlo via e-mail al personale di riferimento del Centro specialistico di ittiopatologia. In contemporanea, verrà organizzato con il Centro il trasporto del campione biologico.
  1. Inserimento nel database dei campioni ricevuti
    I campioni inviati saranno presi in consegna dal Centro e, se ritenuti idonei, verranno sottoposti ad analisi. Se gli esiti delle analisi risulteranno concordi con quanto dichiarato nel format, le sequenze verranno inserite in Ittiobase.

Dall’avvenuta consegna dei campioni al Centro devono trascorrere mediamente 15 giorni lavorativi per avere il risultato dell’idoneità dei campioni inviati. Ricevuta l’idoneità, i dati verranno inseriti nel database e il nominativo dell’ente/laboratorio inviante verrà inserito tra i “collaboratori esterni” nella sezione “Contatti” dell’applicazione.

Metodiche di identificazione

Identificazione morfologica

Pesci interi, con la cute integra, non eviscerati e forniti di pinne e eventuali appendici cutanee, sono stati identificati applicando le chiavi di riconoscimento proposte dalla FAO e reperibili sul sito web www.fao.org/fishery/species/search/en, che a sua volta rimanda a specifiche monografie riguardo quel gruppo tassonomico.

Per esempio, per i pesci del Mar Mediterraneo la monografia di riferimento è stata: W. Fischer, M.L. Bauchot and M. Schneider (eds.) Fiches FAO d’identification pour les besoins de la pêche. (rev. 1). Méditerranée et mer Noire. Zone de pêche 37. Vol. II. Commission des Communautés Européennes and FAO, 1987, Rome. 

Isoelettrofocalizzazione

L’isoelettrofocalizzazione (IEF) è il metodo di laboratorio più impiegato in Italia per il riconoscimento delle specie ittiche, la cui adozione a tecnica di prova è stata raccomandata anche dalla FAO perché consente l’identificazione corretta dei prodotti maggiormente commercializzati mediante costruzione di banche dati di tracciati. Tecnica di semplice esecuzione, l’IEF entra in gioco per tutti quei prodotti ittici (tranci, filetti, hamburger di pesce) che hanno perso l’integrità anatomica, o per quelle specie che hanno particolarità morfologiche molto spinte da rendere insufficiente o inapplicabile l’identificazione morfologica, basata sulla verifica delle caratteristiche tassonomiche immediatamente riconoscibili.

L’IEF sfrutta il diverso punto isoelettrico delle proteine muscolari dei diversi pesci, ossia il punto specifico in cui le cariche elettriche presenti nella sua superficie proteica si equivalgono (focalizzazione della proteina). Si generano così bande specifiche ciascuna specie, tracciati differenti per ogni campione comparabili con quelli inseriti nelle banche dati straniere. Ittiobase, la banca dati isoelettroforetica dell’IZSVe, è composta attualmente da tracciati standard di 76 specie comunemente commercializzate in Italia e rappresenta un patrimonio in continuo ampliamento.

Le proteine sarcoplasmatiche dei pesci presentano una differenziazione nella struttura primaria, che conferisce alle proteine una carica diversa, dipendente dal numero di amminoacidi basici e di amminoacidi dicarbossilici presenti nella molecola. I gruppi carbossilici e amminici liberi presenti nelle catene laterali delle proteine possono ionizzarsi e portare, quindi, una carica elettrica (gruppi ionogeni). I gruppi acidi si dissociano perdendo ioni H+ e si caricano negativamente; i gruppi basici si ionizzano acquistando ioni H+ e assumono carica positiva. L’insieme dei gruppi ionogeni e dei gruppi terminali liberi, carbossilico e amminico determinano le proprietà elettriche delle proteine.

Ogni proteina possiede un valore di pH, definito punto isoelettrico (pI), a livello del quale la ionizzazione dei gruppi carbossilici equivale ai gruppi amminici, e quindi la carica netta della proteina è uguale a zero. L’elettroforesi consiste nella migrazione delle proteine in un campo elettrico e dipende dal valore del pH della soluzione.

Le proteine nella loro forma nativa presentano una superficie con un carattere prevalentemente idrofilico e un interno prevalentemente idrofobico. In un tampone fisiologico esse rimangono in soluzione grazie all’acqua che forma legami idrogeno con i residui presenti sulla loro superficie. Una proteina dispersa in un gradiente di pH, si troverà ad avere carica netta positiva, negativa oppure nulla (se si trova già a un pH pari al suo pI). Sottoposta all’azione di un campo elettrico opportunamente orientato essa si muoverà, a seconda della carica che reca, verso l’elettrodo di segno opposto fino a raggiungere il pH pari al suo pI. In questo punto, essa assume carica netta nulla e non è più sottoposta all’azione del campo elettrico. Se per una qualsiasi ragione essa si muove a destra o a sinistra, allontanandosi dalla regione dove pH=pI, essa assume carica e viene nuovamente focalizzata. Questo conferisce l’alta risoluzione che si ha nelle analisi di isoelettrofocalizzazione.

Prova di sequenziamento

Il prodotto di amplificazione ottenuto viene quantificato e purificato per poter essere sottoposto alla reazione di sequenziamento. La purificazione si ottiene tramite l’uso del kit commerciale “Illustra ExoSTAR-1” (Fisher Scientific) seguendo le indicazioni del fornitore. Nel caso di prodotti di PCR contenenti bande multiple e aspecifiche, si procede con l’estrazione della banda della lunghezza attesa tramite l’uso del kit “Qiaquick Gel Extraction” (Qiagen) e la sua successiva quantificazione.

L’amplificato purificato viene quindi sottoposto a reazione di sequenziamento utilizzando entrambi i primers di amplificazione, ottenendo così due sequenze complementari (figura del ferogramma). Per la reazione di sequenziamento si utilizza il kit “BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies) in un volume finale di 10 µl contenenti: 1 µl di primer specifico (concentrazione 3.3 µM), 1,5 µl di Sequencing Buffer, 1 µl di TRRM, da 1 a 6,5 µl di DNA (a seconda della quantità dell’amplificato). La mix così ottenuta viene sottoposta ad una reazione di PCR con le seguenti condizioni termiche: 25 cicli di 96°C per 10 secondi, 50°C per 5 secondi e 60°C per 2 minuti.

Il prodotto di amplificazione della reazione di sequenza viene successivamente purificato per la rimozione dei reagenti in eccesso. A seconda del numero di amplificati da sequenziare si utilizzano due diversi kit commerciali: “Illustra AutoSeq G-50 Dye Terminator Removal” (GE-Healthcare) nel caso di un numero limitato di amplificati, “Performaâ DTR Ultra 96-Well Plates kit (Edge Biosystem) nel caso di un numero elevato di amplificati da analizzare.

I campioni così ottenuti vengono caricati nel sequenziatore (ABI Prism 3130xl Genetic Analyzer (Applied Biosystems) per l’elettroforesi capillare. Le sequenze ottenute (figura della sequenza) vengono analizzate con i softwares dedicati Sequencing Analysis 5.2 e SeqScape v2.5 seguendo le specifiche del fornitore.

Metodiche biomolecolari per identificazione specie ittiche

Esempio di elettroferogramma. I due tracciati sono relativi ai due strand complementari amplificati con i due primers di apmlificazione. In alto si trova la sequenza di riferimento con la quale comparare le sequenze ottenute (sequenza del cytochrome oxidase subunit I (COI) gene) .

AAGATATTGGCACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATGGTGGGCACAGCCCTAAGTCTCCTAATCCGTGCAGAACTTAGCCAACCTGGGGCTCTCCTTGGAGACGACCAGATCTATAATGTTATTGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTCTAATTGGAGGGTTTGGAAACTGACTAATTCCTCTTATGATCGGAGCGCCAGATATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTTCCCCCCTCATTCCTCCTACTACTAGCCTCCTCCGGAGTTGAAGCCGGGGCGGGGACCGGGTGAACGGTATATCCTCCTCTGTCAGGAAATCTGGCCCATGCAGGAGCATCAGTTGACCTAACCATTTTTTCACTTCATCTAGCAGGTATTTCCTCTATTCTAGGGGCCATTAATTTCATTACCACAATTATTAATATGAAACCACCCGCAATCTCACAATACCAAACGCCTCTGTTTGTCTGATCCGTTCTTGTTACAGCTGTTCTACTTCTTCTATCGCTGCCTGTGCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATTCTATACCAACACCTATTCTGATTCTTCG

Esempio di sequenza finale ottenuta dal campione in figura. Dopo analisi BLAST questa sequenza è stata identificata come Clupea harengus cytochrome oxidase subunit I (COI) gene.

Normative

Nel settore ittico il punto di partenza per la filiera diventa la conoscenza dell’origine del prodotto pescato o allevato che sia. A tal proposito il decreto del ministero delle Politiche agricole alimentari e forestali (MiPAAF) del 27 marzo 2002, che recepisce il regolamento CE n. 104 del Consiglio del 17 dicembre 1999 (la cui applicazione è stata stabilita dal regolamento CE n. 2065 della commissione del 22 ottobre 2001), prevede che, in fase di vendita al dettaglio, il prodotto fresco, surgelato, salato ed essiccato, riporti le seguenti informazioni obbligatorie (art.1):

  • la denominazione commerciale della specie
  • il metodo di produzione: pescato, pescato in acque dolci o allevato (come da rettifica al regolamento 2065/2001, pubblicata sulla G.U. CE del 12 gennaio 2002);
  • la zona di cattura, secondo le zone FAO.

Per tutte le altre fasi di commercializzazione (art. 2), oltre ai suddetti punti, deve essere aggiunta la denominazione scientifica della specie interessata (secondo la nomenclatura binomia). Quindi, ad esempio, per una pescheria, che vende il prodotto al dettaglio un branzino dovrà essere così identificato:

  • specie: branzino;
  • metodo di cattura: pescato;
  • origine: mare Mediterraneo (oppure zona FAO n.37).

Invece per un commerciante all’ingrosso l’identificazione dovrà contenere anche la corretta denominazione latina:

  • Specie: branzino (Dicentrarchus labrax)
  • Metodo di cattura: pescato
  • Origine: mare Mediterraneo (oppure zona FAO n.37)

Il ministero della Marina mercantile, il 15 luglio 1983 ha emanato la prima lista di prodotti ittici con denominazione commerciale obbligatoria, cui sono seguite negli anni altre liste aggiornate, fino all’ultimo decreto, emanato dal MiPAAF il 5 marzo 2010 (G.U. n. 124 del 29 maggio 2010), per un totale di 788 specie. Questo significa che se una specie è prevista nell’elenco deve essere denominata solo ed esclusivamente con quel nome commerciale. Una specie che non figura nell’elenco può essere commercializzata con una denominazione commerciale provvisoria stabilita dall’autorità competente dello Stato membro della UE. Entro i cinque mesi successivi all’attribuzione della denominazione commerciale provvisoria della specie in questione, lo stato membro provvede a stabilire la denominazione commerciale definitiva, che è ripresa nell’elenco delle denominazioni autorizzate (reg. CE 2065/2001, art. 2, comma 1). Un esempio: il Morone saxatilis, specie di acqua dolce di origine nord mericana, era chiamato “branzino striato”, ma da quando è stata inserita nell’elenco ufficiale, è d’obbligo la denominazione “persico-spigola”.

Per approfondire

  • Decreto MiPAAF 12 agosto 2011. Attribuzione della denominazione in lingua italiana di alcune specie ittiche (GU n. 208 del 7.9.2011) | PDF

Riferimenti normativi

  • Regolamento CE n. 104/2000 del 17/12/2000, relativo all’organizzazione comune dei mercati nel settore dei prodotti della pesca e dell’acquacoltura, GUCE serie L 17 del 21/1/2000
  • Regolamento CE n. 2065 della Commissione del 22 /10/ 2001, che stabilisce le modalità d’applicazione del regolamento (CE) n. 104/2000 GUCE serie L 278 del 23/10/2001
  • Regolamento CE n. 178 del Parlamento e del Consiglio del 28/01/2002, che stabilisce i principi e i requisiti generali della legislazione alimentare, istituisce l’Autorità europea per la sicurezza alimentare e fissa procedure nel campo della sicurezza alimentare, GUCE serie L 031 del 1/2/2002
  • Decreto MIPAAF del 27/03/2002 in applicazione dei Regolamenti (CE) n. 104/2000 e n. 2065/2001 (recepisce per l’Italia quanto previsto relativamente all’etichettatura e ai sistemi di controllo per i prodotti ittici), GU n. 84 del 10/04/2002
  • Decreto MIPAAF del 25 luglio 2005, Modifiche e integrazioni all’elenco delle denominazioni commerciali dei prodotti ittici, allegato al decreto ministeriale 14 gennaio 2005. G U n. 181 del 5/08/2005
  • Decreto MIPAAF del 31/01/2008, denominazione in lingua italiana delle specie ittiche indicate nell’elenco allegato che costituisce parte integrante del presente decreto e che sostituisce l’elenco allegato al decreto ministeriale del 25/07/2005, GU n. 45 del 22 /02/2008
  • Decreto MIPAAF del 5/03/2010, integrazione elenco decreto ministeriale del 31/01/2008, GU n. 124 del 29/05/2010
  • Decreto MiPAAF del 12/08/2011, Attribuzione della denominazione in lingua italiana di alcune specie ittiche, G.U. n. 208 del 07/09/2011.

Catalogo delle specie ittiche

  • Denominazione dei prodotti della pesca e dell’acquacoltura presenti sul mercato del Veneto
    Elenco dei prodotti della pesca presenti sul mercato Veneto non inseriti nel decreto ministeriale MiPAAF del 31 gennaio 2008 e successive integrazioni (in rosso le ultime denominazioni provvisiorie inserite) | Sarica PDF
  • Denominazione in lingua italiana delle specie ittiche di interesse commerciale
    Decreto del ministero delle Politiche agricole alimentari e forestali del 31 gennaio 2008 (G.U. n. 45 del 22 febbraio 2008) e successive integrazioni fino al decreto 19 novembre 2012 (G.U. n. 27 del 1 febbraio 2013) | Sarica PDF
  • Denominazione in lingua latina delle specie ittiche di interesse commerciale
    Decreto del ministero delle Politiche agricole alimentari e forestali del 31 gennaio 2008 (G.U. n. 45 del 22 febbraio 2008) e successive integrazioni fino al decreto 19 novembre 2012 (G.U. n. 27 del 1 febbraio 2013) | Sarica PDF

Altre informazioni sono disponibili sul sito web della Regione del Veneto, alla voce Denominazione corretta dei prodotti della pesca.

Contatti

Gruppo di lavoro

Collaboratori esterni

  • Paolo Antonetti – ASL 12 Veneziana
  • Cristian Magnabosco – ricercatore biotecnologo
  • Michele Civettini – ricercatore biotecnologo
  • Nik Silvester – informatico programmatore
  • Vincenzo Brandolini – Università di Ferrara
  • Annalisa Maietti – Università di Ferrara
  • Paola Tedeschi – Università di Ferrara

Ultime news

Identificazione di specie di molluschi bivalvi mediante pirosequenziamento

Identificazione di specie di molluschi bivalvi mediante pirosequenziamento

Lo sviluppo del commercio dei prodotti ittici negli ultimi anni a livello globale ha segnato anche un aumento delle frodi commerciali di prodotti…

Leggi tutto >

Prodotti ittici in mensa: quali rischi alimentari in scuole, ospedali e case di cura?

Prodotti ittici in mensa: quali rischi alimentari in scuole, ospedali e case di cura?

Negli ultimi anni pesci, molluschi e crostacei sono diventati un alimento sempre più richiesto dalle mense pubbliche di ospedali, case di cura…

Leggi tutto >

Puoi visualizzare tutte le notizie, gli aggiornamenti e gli approfondimenti su questo tema nella sezione “News” del sito, alla pagina News > News per temi > Alimenti sicuri > Identificazione di specie ittiche

Vai alle news sul tema Identificazione di specie ittiche »
© Istituto Zooprofilattico Sperimentale delle Venezie
Istituto Zooprofilattico Sperimentale delle Venezie
Viale dell'Università 10, 35020 Legnaro (PD)
Tel: +39 049 8084211 | Fax: +39 049 8830046
E-mail: comunicazione@izsvenezie.it
PEC: izsvenezie@legalmail.it (Guida alla PEC)
C.F. / P.IVA: 00206200289
Protocollo: lun-ven. 9-13 | giov. 9-13 e 14-15.30